521 a case statement that is not full or parallel 522
Báo cáo y học: "Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation" ppt
Ngày tải lên :
14/08/2014, 14:21
... thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana A and A' label the start and ... Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D575-D577 NASCA Arrays: Affymetrix ATH1 arrays database [http:// affymetrix.arabidopsis.info/narrays/experimentbrowse.pl] ... prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana Genome Biol 2005, 6:R30 Kiyosawa H, Yamanaka I, Osato N, Kondo S, Hayashizaki Y: Antisense transcripts with FANTOM2...
- 10
- 234
- 0
Báo cáo khoa học: Cyclosporin A-induced oxidative stress is not the consequence of an increase in mitochondrial membrane potential doc
Ngày tải lên :
30/03/2014, 08:20
... cells to CsA Elzinga et al showed that Ca2+ uptake by mitochondria isolated from renal cortical cells of rats that had been treated with CsA for weeks was significantly lower than Ca2+ uptake by mitochondria ... DCF fluorescence was monitored with an excitation wavelength of 485 nm through a 530 nm bandpass filter in an FL500 fluorescent plate reader Statistical analysis Data were analyzed using prism for ... suggest increases in cytosolic [Ca2+] in response to CsA and its analogs Both the intracellular Ca2+ chelator BAPTA and the extracellular Ca2+ chelator EGTA caused significant attenuation of the...
- 10
- 455
- 0
Báo cáo khoa học: "When is a GIST not a GIST? A case report of synchronous metastatic gastrointestinal stromal tumor and fibromatosis" ppt
Ngày tải lên :
09/08/2014, 04:21
... old man was diagnosed with a gastric antral tumor after investigations for symptomatic anemia A barium swallow confirmed the presence of tumor causing subacute gastric outlet obstruction Laparoscopy ... in AF or intra-abdominal keloid type fibrocollagenous scar Mutation analysis that was performed on the mesenteric tumor further clarify that this mass, which was absent of Exon 11 C-KIT mutation, ... possibility of an alternative diagnosis to GIST recurrence Although surgical resection of this mesenteric mass may remain necessary, a correct diagnosis has important implication for his future systemic...
- 4
- 297
- 0
Báo cáo y học: "Severe heparin-induced thrombocytopenia: when the obvious is not obvious, a case report" pptx
Ngày tải lên :
11/08/2014, 10:22
... funding, or salary from an organization that may in any way gain or lose financially from the publication of this manuscript, either now or in the future No organization is financing this manuscript ... draws for PT/INR were done at least six hours after temporary cessation of argatroban infusion, and an INR goal between 2–3 was attained Argatroban was discontinued after five days of overlap ... consultants included accelerated platelet removal from the circulation owing to CVVHD and sepsis-related disseminated intravascular coagulation Two days later, right hand cyanosis was noted and attributed...
- 5
- 372
- 0
Báo cáo khoa hoc:" Perigraft air is not always pathological: a case report" docx
Ngày tải lên :
11/08/2014, 10:22
... and inflammatory markers remained within normal limits As the patient was now apyrexial and continued to be asymptomatic, the decision was made to discharge the patient A repeat CT scan performed ... The author(s) declare that they have no competing interests Authors' contributions All authors have read and approved the final manuscript Acknowledgements The original idea was that of G Morris-Stiff ... following his aortic surgery showed that the perigraft air had completely resolved and the haematoma had organised The patient has been followed up for two year post-operatively and remains asymptomatic...
- 3
- 280
- 0
Báo cáo y học: "Pancreas divisum and duodenal diverticula as two causes of acute or chronic pancreatitis that should not be overlooked: a case report" doc
Ngày tải lên :
11/08/2014, 23:21
... 55:543-547 Kamisawa T, Tu Y, Egawa N, Tsuruta K, Okamoto A, Kamata N: MRCP of congenital pancreaticobiliary malformation Abdom Imaging 2007, 32:129-133 Lehman GA: Acute recurrent pancreatitis Can J Gastroenterol ... incidence of pancreatitis It is well known that the principal cause of acute pancreatitis is biliary microlithiasis It is also true that biliary lithiasis can be determined, as discussed above, by the ... presentation A 75-year-old man with a clinical history of recurrent pancreatitis (more than two episodes of acute pancreatitis) without risk factors (for example, no previous alcohol abuse, gallstones,...
- 4
- 267
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
Ngày tải lên :
20/12/2013, 23:15
... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along...
- 8
- 416
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
Ngày tải lên :
15/02/2014, 01:20
... This work This work This work Reference Fermentas [25] Pharmacia [29] [24] This work This work This work This work This work This work This work This work This work This work This work This work ... sample plate The droplet was air-dried before analysis in the MS MALDI spectra [28] [26] This work This work This work This work This work This work This work This work This work This work This ... This work Novagen This work This work This work This work This work This work This work were obtained in reflectron mode and a nitrogen laser, emitting 337 nm light in a ns pulse, was the ionization...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
Ngày tải lên :
16/02/2014, 14:20
... immobilized metal affinity chromatography and anion exchange chromatography, as previously described for PDIs from Caenorhabditis elegans [40], except that for PDI a domain and DsbA, the anion exchange ... propose that bacitracin should not be regarded as a specific inhibitor of PDI Results Bacitracin does not inhibit the catalysis of disulfide bond formation and isomerization by PDI PDI is a catalyst ... thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding...
- 9
- 620
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
Ngày tải lên :
07/03/2014, 05:20
... 7.5, and enzyme (1.25 lm for the wild-type and Ser127Ala mutant proteins or 12.5 lm of the Ser16Ala and Ser16AlaSer127Ala mutant proteins) Chorismate formation was monitored at 275 nm under anaerobic ... demonstrates that the Ser16AlaSer127Ala double-mutant protein, in contrast to the single-mutant proteins (Ser16Ala and Ser127Ala) is not capable of forming the flavin-derived intermediate The decay rate ... Neurospora crassa has an intrinsic NADPH:FMN oxidoreductase activity that enables the enzyme to generate the reduced FMN cofactor (bifunctionality) The structural basis of this ‘secondary’ catalytic...
- 10
- 398
- 0
''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf
Ngày tải lên :
07/03/2014, 17:20
... have a symbolic diegetic meaning — for instance, a player manipulates an avatar through a flash environment to earn game world points that translate into game currency, or a player investigates ... social and political action The genre's repeated disavowals that "this is not a game" is more than a catchy tag line; it is a call for further study, development and deployment of immersive gaming's ... unfolding of the answers IS the narrative that has me hooked… a meta-narrative" [20] In another editorial "Meta Mystery," Maria Bonasia, a twentysomething Massachusetts-based playwright, discussed "the...
- 10
- 583
- 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
Ngày tải lên :
08/03/2014, 10:20
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...
- 11
- 501
- 0
Báo cáo Y học: Regulation of RAS in human platelets Evidence that activation of RAS is not sufficient to lead to ERK1-2 phosphorylation pot
Ngày tải lên :
08/03/2014, 16:20
... family kinases and suggest that activation of RAS is dispensable for efficient activation of ERK DISCUSSION Activation of RAS was evaluated in platelets through the ability of the activated RAS–GTP ... ERK in platelets RAS–RAF interaction and subsequent regulation of ERK is not the only pathway regulated by RAS For instance, a mutated form of RAS that is unable to bind RAF is still able to induce ... observation that TPO, which is unable to induce activation of PKC, does not stimulate activation of ERK in platelets This result indicates that activation of RAS is not sufficient on its own to lead...
- 7
- 436
- 0
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf
Ngày tải lên :
15/03/2014, 14:20
... adopted afterwards, the average of the actual annual inflation rate in the sample is taken as the target for that year One-year-ahead inflation expectations are based on one-year-ahead WEO forecasts ... data was interpolated Data was seasonally adjusted using an X-12 ARIMA seasonal adjustment Public Debt 2012 April WEO Yearly actual and projected data was interpolated Data was seasonally adjusted ... interpolate his torical data PRY: Letras Regulacion Monetaria URU: Policy rate; money market rate was us ed as a proxy for his torical data 12-m onth ahead inflation expectations 2012 April WEO Data...
- 48
- 504
- 0
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc
Ngày tải lên :
16/03/2014, 19:20
... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C(y1 , y2 ) C(ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... L(G), a derivation tree for w is a derivation tree for some S(w1 , w2 ) such that w1 w2 = w Example (continued) Figure shows a derivation tree for aa¯ aa¯ #¯ a aaa a a a a The following lemma...
- 9
- 374
- 0
odysseus is not a hero
Ngày tải lên :
21/03/2014, 22:48
... killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about people 1) Elpenor ... this.Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...
- 2
- 408
- 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
Ngày tải lên :
22/03/2014, 20:20
... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in [T], ... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... ∗ -algebras, and let x1 , , xr and y1 , , yr be operators in Asa and Bsa , respectively Assume that for all m ∈ N and all matrices 715 A NEW APPLICATION OF RANDOM MATRICES a0 , , ar...
- 66
- 378
- 0